gRNA/CRISPR-Cas9 editing of primary mouse hematopoietic cells

Notes

Day 1. Harvest mouse bone marrow and sort cells to be edited.

• Single yield sort primary mouse hematopoietic cells from into an Eppendorf tube with 500uL sterile PBS + 0.2% BSA.
  • Generally, we cKit-select prior to sort and recover >80K Lin-Kit+Sca1+ cells per adult donor mouse
• Spin down cells and resuspend in 150uL pre-warmed culture media.
• Transfer contents from Eppendorf tube to one well of a 96-well U-bottom culture plate.
  • Plate no more than 100K cells per well
• Culture cells overnight (16-24hr) at 37C, 5% CO_2.

Day 2. Electroporate cells with CRISPR RNP complex.

Keep everything sterile!

1. Add 150uL culture media to an appropriate number of wells on a 96-well U bottom culture plate. Store plate at 37C to keep warm.
   • Each well = one electroporation reaction / recipient
   • Include one additional reaction to save for sequencing
2. Prepare CRISPR reagents. Each aliquot of gRNA / Cas9 will be 10x reactions worth.
   • Dilute 100uM working stock sgRNA to 30uM using sterile, nuclease free H2O:
     • Thaw sgRNA tube and briefly spin down
     • Add 7uL H2O to 3uL sgRNA and pipette gently to mix
       • Thaw Cas9 aliquot and briefly spin down
       • If needed, thaw ssODN on ice
3. Make a master mix using 1uL diluted sgRNA + 1uL diluted Cas9 per reaction. Allow complexes to form for 15 min at room temp.
   • Gently pipette to mix without creating bubbles
4. Pool all sorted cells per genotype into a sterile Eppendorf tube and spin down in the bucket centrifuge at room temp (1500rpm x 5min).
   • After collecting cells, wash wells with an additional 200uL sterile DPBS and add to the cell suspension
5. Aspirate supernatant and wash cells in 300uL sterile DPBS. Spin again.
6. Resuspend cells in Buffer T (from the Neon kit, stored at 4C).
   • Cells should be in 10uL Buffer T per electroporation reaction
   • Note: for editing with multiple guides or adding ssODN, scale down the volume of Buffer T per reaction
     • 8uL cells per reaction if adding second gRNA
     • 9uL cells per reaction if adding ssODN
7. Once RNP master mix has formed, add 2uL to RNase-free sterile PCR tubes, one PCR tube per reaction.
   • Pipette slowly to avoid forming bubbles or splashing onto the sides of the tube
   • For experiments using multiple guides, prepare each gRNA complex separately, then combine after the 15 min incubation period
   • For experiments using ssODN, add 1uL ssODN to each PCR tube after adding RNP and pipette gently to mix
8. Add appropriate volume of cells in Buffer T to each PCR tube.
   • Gently pipette to mix to avoid creating bubbles—if a bubble forms, try to pop it with the pipette tip
9. Setup the Neon electroporation system.
   • Insert a plastic cartridge into the device (should snap into place) and add 3mL Buffer E
   • Have the pre-warmed culture plate ready
   • Get the Neon pipette and 10uL electroporation tips
10. Load a 10uL tip onto the Neon pipette and pipette some Buffer T to pre-wet the tip. Discard the buffer.
11. Gently draw up cell/RNP mixture without creating any bubbles.
12. Insert the pipette into the cartridge (should gently snap into place) and select the electroporation program.
    • For 16hr overnight cell culture, use 1700V, 20ms, 1 pulse
    • For 24hr cell culture, use 1350V, 30ms, 1 pulse
13. Click Start on the machine. The program will run and make a gentle clicking sound twice. A completion message will appear on screen once electroporation is completed.
    • Watch the tip for electrical arcing caused by bubbles—will appear as a brief spark and may lead to lower editing/viability
14. Immediately transfer electroporated cells to one well of the pre-warmed plate. Gently pipette up and down 2-3 times to mix cells into the media.
15. Repeat for all samples.
    • Change tips as needed for different reaction conditions, or if a bubble gets stuck in the tip, but try to reuse the tips several times if possible
16. Rest electroporated cells at 37C, 5% CO2 for about 6hr prior to transplant. Keep the sequencing wells in culture for about 72hrs before harvesting for DNA.

Day 2. Transplant edited LSKs into recipient mice.

• Lethally irradiate recipient mice (2x doses 550 rads).
• Isolate BM from radioprotective donor mouse and count cells to determine volume for 500K radioprotection cells per recipient.
  • Combine replicates of electroporated cells into one Eppendorf tube.
  • Be sure to leave the designated wells in culture for sequencing
• Wash wells with 100uL DPBS and add to cell suspension before spinning down
• Spin down cells in bucket centrifuge at 4C (1500 rpm x 4min), then add correct volume of radioprotective BM cells.
• Spin down again and resuspend for transplant.

Day 5-6. Harvest DNA for sequencing analysis.

1. Collect remaining cells from the culture plate into Eppendorf tubes.
   • Keep each well separate
   • Wash out each well with an additional 200uL DPBS and combine with the cell suspension
2. Spin down cells (1500 rpm x 5 min) and wash cell pellet with 300uL DPBS.
3. Spin down and resuspend in lysis buffer.
   • For each sample, use 50uL Viagen Lysis reagent + 1uL Proteinase K
4. Place tubes in 56C water bath for 20 min.
5. Move tubes to 95C heat block for 10 min.
   • Spin down briefly to collect condensation drops from inside the lid
6. Store DNA at 4C (store long term at –20C).

Day 6+. Perform 2-step PCRs for NGS.

Notes:

1. Setup adaptor PCR in 20uL reactions to amplify the sgRNA target region using EconoTaq high-fidelity polymerase.
   • 10uL EconoTaq 2X master mix
   • 6uL nuclease-free H2O
   • 2uL template DNA isolated from CRISPR-edited cells
   • 1uL each adaptor primer (diluted to 20uM)
2. Run the following PCR program (cycle # and Anneal temp will depend on specific primer set optimization).
   • 94C x 2min -> [94C x 15 sec – 57C x 15sec – 72C x 40 sec] -> 72C x 5 min -> hold 4C
3. Add loading dye to each sample and run the entire volume on a 1.5% agarose gel.
   • Use wider tooth combs when pouring the gel
4. Run gel at 150V x 45 min and image to confirm correct product size. May have some primer dimers and/or nonspecific bands that will need to be eliminated.
5. Excise the correct size fragment from the gel and cleanup using the Takara kit protocol.
   • Spin-dry the columns for 3 min instead of 1 min after washing
   • Elute in 12uL nuclease-free H2O at the final step instead of buffer
6. Setup the index PCR using 2uL purified product from 1^st PCR.
   • Each sample will use a unique index primer (indexes assigned by the SIC at WashU); for example, CAAGCAGAAGACGGCATACGAGATTAAGCGTAGGTGACTGGAGTTCAGACGTGTGCTC
   • All samples will use the universal primer: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTC
7. Use EconoTaq 20uL reaction:
   • 10uL EconoTaq 2X master mix
   • 7.2uL nuclease-free H2O0.4uL each primer (universal paired end and index, 100uM)
   • 2uL purified product after PCR-1
8. Run the following PCR program for 10 cycles.
   • 94C x 1min -> [94C x 30 sec – 60C x 30sec – 72C x 40 sec] -> 72C x 5 min -> hold 4C
9. Repeat steps 3-5 above (run indexed samples on 1.5% agarose gel, extract correct size fragment, purify with Takara kit).
   • Elute in 15uL Buffer NE at the final cleanup step
10. Determine concentration of each indexed sample.
    • If using NanoDrop, values should be divided by 3 to alleviate discrepancies in the NanoDrop measurement
11. For MiSeq spike-in cooperative (SIC at WashU) NGS submission, perform the following steps per their guidelines:
    • Dilute each sample to 10nM in 20uL H2O.
    • Prepare a 10uM pool of all samples in 20uL total volume to submit.
      • Can be stored at –20C at this step if needed
    • Submit samples to MiSeq spike-in cooperative (SIC). There is a designated freezer on the 4^th floor of Couch Biomed research building.
    • Fill out the sample submission form and email to the listed address.
    • Once the run is completed, the SIC will email with an overview of the read counts for each sample and a link to the deconvoluted sequence files.